1. of diabetes and obesity (Paarakh et al, 2008).

 

1.      Introduction

 Salacia is a liana
which belongs to family Celastraceae
subfamily Salacioideae. In India, Salacia
is distributed in Western Ghat regions of Karnataka, Kerala, Tamil Nadu and is
also distributed in eastern Ghats. Most of the species of genus Salacia are used in traditional medicinal
systems for treatment of diabetes and obesity (Paarakh
et al, 2008). Salacia species are known to
contain anthocyanidines, catechins, quinones, friedo-oleanones, quinonemethide
and mangiferin which are anti-diabetic (Yoshikawa
et al, 2001), anticancer (Yoshimi
et al, 2001), antiviral agent effective against
HIV, Herpes simplex (Guha
et al, 1996; Zheng & Lu, 1990) and major bioactive components such
as salacinol and kotalanol which have ?-glucosidase inhibitory activity (Xie
et al, 2011; Yoshikawa et al, 2002) .

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

 

Species identification in the genus Salacia is difficult when based solely on morphological
characteristics. Although most of the vegetative characters of the species within
the genus are same differences are observed in floral and some fruit
characteristics (Udayan
et al, 2012; Udayan et al, 2013). Therefore, accurate methods of
validation and authentication is indispensable to ensure safe use and efficacy
of extracted raw drugs.

 

RAPD and ISSR simple and quick techniques which does not
require any specific knowledge of the DNA sequence of the target organism. RAPD
detects nucleotide sequence polymorphisms, using a single primer of arbitrary
nucleotide sequence where as ISSR detects of polymorphisms in identical
inter-microsatellite loci oriented in opposite direction, using a 16–25 bp long
primer which are dinucleotide or trinucleotide tetranucleotide or
penta-nucleotide simple sequence repeats (Wu et
al, 1994; Zietkiewicz et al, 1994).ISSRs have high reproducibility
possibly due to the use of longer primers (16–25-mers) as compared to RAPD
primers (10- mers) which permits the subsequent use of high annealing
temperature (45– 60 ?C) leading to higher stringency. Inter transcribed spacer
(ITS) having universal set of primers is biparentally inherited, which varies
in length from 500–700 base pairs and is a popular choice for phylogenetic
analyses(Alvarez
& Wendel, 2003).

 

              In the
present study two DNA markers RAPD and ISSR, and a DNA barcoding region ITS was
used to evaluate genetic diversity within and among four Salacia species-S. chinensis,
S. macrosperma, S. fruticosa, S. oblonga sampled from Western Ghats of
Karnataka.

 

2 Materials and methods

2.1 Sampling

              Twenty-one
samples were collected from various parts of western Ghats (Table 1 for details).
The 21 samples are grouped in four population of Salacia chinensis L., Salacia
macrosperma Wight., Salacia fruticosa
Lawson., Salacia oblonga Wall. ex
Wight & Arn.

2.2 DNA isolation, RAPD, ISSR, ITS reaction

              Genomic
DNA was isolated according to Stange
et al (1998) protocol. DNA was quantified using NanoDrop
2000 Spectrophotometer (Thermo Fisher Scientific) and diluted to 25 ng for use
in polymerase chain reaction (PCR). Reaction mixture contained 100 uM of each
dNTPs (Merck biosciences), 5 uMole of primer (Sigma,USA), 0.5 Unit of Taq DNA
polymerase (Merck biosciences) and 1x Taq buffer (Merck biosciences) in a total
volume of 20 ul. ISSR-PCR amplification was carried out for 40 cycles, with initial
denaturation for 5 minutes at 94°C, followed by cyclic process of denaturation
for 1-minute at 94oC, annealing at temperature standardized for each
primer (Table 2) for 1 minutes and extension at 72°C for 1 minutes, and final
extension at 72 °C for 5 minutes in Applied Biosystems Veriti Thermal Cycler. For
RAPD-PCR, the protocol was similar to ISSR except for the annealing temperature
which was 36°C for all the primers. For the PCR amplification of the ITS
sequence primers ITS4- TCCTCCGCTTATTGATATGC and ITS5- GGAAGTAAAAGTCGTAACAAGG designed
by WHITE
(1990) were used. With amplification
profile as follows 95°C, 1 minute 30 seconds, 28 cycles of 95°C, 30 seconds,
42°C,1 minute, 72°C, 1 minute and 72°C, 3 minutes. Amplified
products were separated in 1.8% agarose gel containing ethidium bromide using
1x TBE buffer. DNA fragments were visualized under UV light. The band patterns
were photographed using Gel Doc™ XR (Bio- Rad).

2.3 Phylogenetic analysis of ITS sequence

              The
amplified products were sent to Chromous biotech, Bangalore for sequencing. The
sequence generated were submitted to NCBI database. For phylogenetic analysis
of ITS sequence MEGA 5 (Tamura
et al, 2011) software was used. Nineteen samples
from current study and an outgroup sequence was used for sequence analysis. The
multiple sequence alignment was performed using CLUSTAL W, version 1.6 (Thompson
et al, 2002). Using MEGA 5 best-fit Model-test
was performed and model with the lowest Bayesian Information Criterion (BIC)
score was selected for further analysis. The Maximum Likelihood tree was
constructed using the best fit model with least BIC score.

 

2.4 Data collection and Analysis

              The
banding patterns obtained from RAPD and ISSR were scored as present (1) or
absent (0), each of which was treated as an independent character regardless of
its intensity and binary matrix was created for RAPD and ISSR primers. The
polymorphic information content (PIC) proposed by Roldàn-Ruiz
et al (2000), marker index (MI) described by Varshney
et al (2007) and resolving power (RP) by Prevost
and Wilkinson (1999) of each marker was calculated.

              POPGENE (Yeh et al, 1999) was used to calculate various paraments such as percentage of
polymorphic band, observed number of alleles (na), effective number of alleles
(ne), Shannon’s information index (I) and Nei’s gene diversity (H) total
heterozygosity (Ht), average heterozygosity (Hs) and gene flow (Nm) between the
populations and among the individuals within each population. The similarity
matrix was subjected to cluster analysis by unweighted pair group method for
arithmetic mean (UPGMA) and a dendrogram was generated.

 

              GenAlEx
6 (Peakall
& Smouse, 2006) was also used to calculate Principal
Coordinates Analysis (PCA) that plots the relationship between distance matrix
elements based on their first two principal coordinates. The product-moment
correlation (r) based on Mantel Z value was computed to measure the degree of
relationship between similarity index matrices produced by any two-marker
systems. The RAPD, ISSR and ITS data were subjected to a hierarchical analysis
of molecular variance (AMOVA), as described by Excoffier
et al (1992).

 

3 Results

3.1 RAPD and ISSR analysis details

              In present
study, initially 40 RAPD primers that is 2 set of Operon primer kits OPG and
OPR (20 primer from each kits) were used to detect genetic polymorphism of S. oblonga, S. fruticosa, S. chinensis
and S. macrosperma. Out of the 40
RAPD primers, 10 primers i.e.  OPG-02,
14, -16, -17, -18, -19 and OPR-02, -03, -07, -08 showed reproducible amplified
DNA polymorphism. All the chosen primers amplified fragments across the 21
samples, with the number of amplified fragments ranging from 4 to 12. Minimum number
of bands were seen in the primer OPG18 (4 bands) and maximum bands were
observed in primer OPG17-12 bands. About 6 bands were observed in rest of the
primers. From the ten primers, a total of 76 loci were generated of which 70
were polymorphic, making polymorphism generated by RAPD makers to be 92.11%. Multiplex
ratio (total number monomorphic and polymorphic loci/ number of assays) of RAPD
analysis was calculated as 7.6. Resolving power of RAPD marker for the observed
76 loci was 54.67. While in ISSR analysis 10 primers produced 67 loci of which
61 bands were polymorphic, accounting for 91.04% of polymorphism. Number of
bands varied from four (ISSR 5) to nine (ISSR 10), and sizes ranged from 200 to
2,500 bp. Multiplex ratio of ISSR analysis is calculated as 6.8. Resolving
power of ISSR marker for the observed 67 loci was 58.48. The Marker index which
determines overall efficiency of marker system is calculated by (MI) = Hav X MR
where Hav was average heterozygosity and MR is multiplex ratio. The marker
index for RAPD was (0.859×7.60) 6.54 and ISSR marker was (0.801×6.8) 5.45.

 

              Data for
observed number of alleles, effective number of alleles, Nei’s genetic
diversity, Shannon’s information index, for 21 samples of Salacia species analyzed using ten RAPD markers and
their respective values were found as 1.9211, 1.4537, 0.2785, 0.4294 respectively
and for ISSR these values are 1.9104, 1.5108, 0.2988, 0.4509 respectively. Total
genotype diversity among population (Ht) was estimated to
be 0.2713 while within population diversity (Hs) was estimated to be 0.1514 for
RAPD and for ISSR Ht was 0.3055 and Hs was 0.1222. Mean coefficient of gene
differentiation (Gst) value for RAPD was 0.4418 which indicated that 55.8% of
the genetic diversity resided within the population and for ISSR Gst was 0.5999.
Estimates of gene flow in the population for RAPD and ISSR were 0.6318 and
0.3334 respectively. (Table 3).

 

3.2 Dendrogram and PCA of RAPD and
ISSR

In RAPD dendrogram,
based on UPGMA analysis, 21 samples of Salacia
grouped into two clusters (Cluster 1 and 2). Cluster 1 contained S. chinensis SC1 to SC5 and cluster 2 was
further divided into two sub-clusters (sub-cluster 1 & 2). In cluster 2,
sub-cluster 1 contained all samples of S.
macrosperma along with two samples of S.
fruticosa SF1 & SF3 (Fig 1) and sub-cluster 2 contained three remaining
samples of S. fruticosa along with S. oblonga samples. The three most
informative Principle components explained 65.68 % of cumulative total
variation. Dendrogram of ISSR data showed that the samples clearly grouped into
four clusters (I, II III and IV) of its respective species S. chinensis, S. macrosperma, S. fruticosa, S. oblonga. The first
three most informative Principle components explained 74.05% of the total
variation. The results of RAPD and ISSR PcoA analysis were comparable to the
cluster analysis (Fig 2).

3.2 ITS analysis

              For ITS
analysis, 19 samples of current study and an outgroup Pristimera preussii belonging to sub-family Hippocrateoideae was used
to construct phylogenetic tree. Two samples SM1 and SM14 produced faint bands
and could not be sequenced. Sequence alignment of 20 samples resulted in
overall sequence length of 752 bp, of which 221 bp (29.38%) were conserved, 503
bp (66.88%) were variable and 103 bp (13.69%) were parsimony informative sites.
Three major clades were observed from ML tree. Clade 1 contained all the
samples of S. macrosperma

along with samples of S.
oblonga which were nested with-in the clade. Clade 2 and 3 contained S. chinensis and S. fruticosa samples respectively (Fig 3).

3.4 Comparative analysis of population

              Values of observed
number of alleles, effective number of alleles, Nei’s genetic diversity,
Shannon’s information index of each population were compared to observed
diversity and degree of polymorphism with-in the population (Table 3 and 4). In
comparison, the RAPD values were marginally higher than the ISSR except in the S. fruticosa population. Significant
differences were observed in all the parameters. Highest percentage of
polymorphism and highest polymorphic loci were seen in S. fruticosa population in RAPD analysis. In RAPD, ISSR and ITS
analysis high degree of polymorphism was seen in S. macrosperma and S. fruticosa
population followed by S.chinensis
population. Although only two samples are in S. oblonga population, RAPD, ISSR and ITS analysis detected
polymorphism of 15.79%,16.42%,23.36% respectively. Also, in parameters such as Ht,
Hs, Gst and Nm significant differences in value were observed (Table 4). The
level of polymorphism revealed by RAPD was (41.45%±10%) which was higher than
ISSR (33.58%±6.52%) and ITS 25.50% ± 17.25%. The polymorphism of each population of S. chinensis, S macrosperma, S. fruticosa and S. oblonga from RAPD was 35.53%, 55.26%, 59.21%, 15.79% and ISSR was 32.84%, 47.76%,37.31%,16.42%
respectively.

For comparative analysis of ITS with the RAPD and ISSR,
sequences data of ITS was analyzed in GenAlEx. Before exporting the data, the
outgroup sequence and sequence SF5 were removed. Only polymorphic nucleotide positions
were converted to numeric codes (A=1, C=2, G=3, T=4, hypen/colon=5) and 137
sites showed the polymorphism which were used for the further analysis. The
polymorphism of each population of S.
chinensis, S. fruticosa, S macrosperma and S. oblonga from ITS analysis was 6.57%,19.71%,24.82%,23.36% and
overall polymorphism was 18.61%±4.16%. For ITS, coefficient of evolutionary
differentiation was 0.797 which indicated that 20.3% of the genetic diversity
resided within the population. Tajima’s D neutrality tests were performed to check whether genus Salacia populations followed a neutral
model of evolution with constant population size over time. The observed values
of Tajima’s D neutrality tests were -1.089757 for S. macroperma and S. oblonga
population, -1.105205 for S. fruticosa
and -0.174749 for S. chinensis and-1.
181277 for all the 19 samples. After removing sample SF5 since it showed high
divergence, neutrality test was performed for 18 sample of Salacia which gave observed value of 0.606285.

AMOVA,
which helps in partitioning of the overall variations among groups and among
populations within the group were performed for RAPD, ISSR and ITS data
matrices. From RAPD, 39% of molecular variance was found among population
while, within the population this value was found to be 61% indicating that
there were more variations within the population. While in ISSR, 55% molecular
variance was found among population and 45% within the population. For ITS sequence
analysis 80% variances was among the population and 20% variance was within
population which was similar to coefficient of evolutionary differentiation.
(Table 5).

Nei
genetic pairwise distance of Salacia
species was found to be > 0.5 for RAPD, ISSR and ITS sequence. But in ITS
sequence analyis, the pair-wise distance between the S. oblonga and S. macrosperm
was 0.061 suggesting that they are very closely related. In addition, the
pair-wise distance and identity of S.oblonga
and S.fruticosa was 0.915 and 0.088
indicating that they are highly dissimilar. (Table 6).

              Mantel
test was employed to determine the coefficient of correlation between the genetic
distance matrices generated by RAPD and ISSR markers. The coefficient of
correlation between RAPD and ISSR marker was R2=0.3781, r=0.614
which is high. This value signifies that there were considerable correlation
between RAPD and ISSR genetic distances matrices. Twenty-one samples grouped into
two clusters in RAPD dendrogram whereas in ISSR dendrogram four cluster were
observed. Comparing RAPD dendrogram with ISSR dendrograms we can notice that S. oblonga was an Operational Taxonomic
Units (OTU). In all analysis, results of cluster analysis were comparable to PcoA.

 

              Mantel
test was also employed to analyze the ‘goodness of fit’ for each marker system.
This was done by comparing cophenetic similarity matrices of genetic distance
with cophenetic similarity matrices with the Nei Genetic Distance for each
marker technique. It revealed values higher than 0.80 for all the markers used
RAPD (r = 0.827, P = 0.01), ISSR (r = 0.816, P = 0.01) thus confirming their
authenticity and very good fit of PCA clustering.

 

4 Discussion

 

              DNA
markers have been used to evaluate genetic diversity in various plant species.
In general, RAPD is increasingly being employed in genetic research owing to
its speedy process and simplicity. On the other hand, ISSR marker has high potential
to reveal polymorphism at intra- and intergenomic level to determine diversity than
compared RAPDs (Zietkiewicz et al., 1994).

 

              In current
study, we have compared the applicability of ISSRs and RAPDs as genetic markers
to characterize the Salacia species. The
only reports on genetic diversity on genus Salacia
was carried out  by Priya
et al (2016) who used RAPD molecular markers to
asses diversity of samples collected from Wayanad region in Kerala. In the
present study, an attempt has been made to examine the level of genetic
variation within Salacia species
sampled in the Western Ghats of Karnataka.

 

              From numbers
and values obtained in the current study it was quite that obvious RAPD is a
better marker than ISSR in evaluating diversity of Salacia species. However, on careful observation it can be observed
that RAPD marker was not able to differentiate S. oblonga samples and it was grouped within S. fruticosa samples. This could be attributed to the fact that the
putatively similar bands originating from RAPD analysis in different
individuals may not necessarily have to be homologous, although they may be of
same size in base pairs which in turn results the erroneous calculation of
genetic relationships (Fernandez
et al, 2002). This also explains the fact that Nei’s
genetic distance and identity between S.
oblonga and S. fruticosa were
considerably high which was contrary to observation seen in dendrogram and PCA.
Resolving power of ISSR was marginally higher than RAPD. Also, the differences
in clustering pattern in RAPD and ISSR markers may also be attributed to
differences in overall number of loci and their coverage of the overall genome,
which would affect reliable estimates of genetic relationships among samples (Loarce
et al, 1996).

 

              In both RAPD
and ISSR analysis S. macrosperma had
high polymorphism within the population which was apparent as the samples were
collected from many different locations. However, in case of S. chinensis, S. fruticosa, and S. oblonga populations the samples were
collected from one location. Despite the samples within the population
originating from one location, a considerable high rate of polymorphism was
observed which was in correlation with the observations made earlier by Priya
et al (2016).Similarly, diversity evaluation of Memecylon species collected from western
Ghats of Karnataka by Ramasetty
et al (2016) using RAPD,ISSR and barcoding genes
found high level of polymorphism in RAPD (65.4%)  and ISSR analysis (68.5%). RAPD and ISSR
markers were also able to effectively detect low polymorphism variation in Garcinia xanthochymus species sampled
across various states of western Ghats (Anerao
et al, 2017) which suggest that RAPD and ISSR are
efficient markers in for diversity analysis.

 

              In the
study by Dev et
al (2015) ITS2 region showed highest
interspecific divergence and 100% efficiency for species identification by nearest
distance method when compared to rbcL, matK and trnH-psbA barcoding regions.
The authors also observed reciprocal monophyly among S. fruticosa, S. chinensis, S.
agasthiamalana and S. macrosperma in the phylogenetic tree generated from
the combined dataset, which was also observed in our current results. The high
divergence of S. fruticosa sample SF5
can be attributed to amplification of ITS pseudogene as it is identified by its
high rate of substitution especially in the ITS2 region. Furthermore, this fact
was validated by AMOVA, since as compared to RAPD and ISSR, ITS had highest
percent of variance (80%) in detecting interspecific or among the species
divergence whereas the RAPD had the lowest (39%). From the AMOVA it can be seen
that there was considerable variation within and among Salacia species. The variation within the species may due to
presence of infrageneric variation in Salacia
species. Evidence can be seen from discovery of variety kakkayamana in S. oblonga (Udayan
et al, 2014). Also, the high variation among
groups was due to the component of genetic variance, as new species S. agasthiamalana (Udayan
et al, 2012)
S. vellaniana (Udayan
et al, 2013) were discovered in western Ghats
of  Kerala. From the study of  Dev et
al (2015) of Salacia species sampled from Kerala, S. oblonga and variety kakkayamana
showed 100% homology, while S. fruticosa,
S. vellaniana, S. chinensis, S. malabarica, S. agasthiamalana  samples formed monophyletic group and S. macrosperma and S. beddomei  were closely
related sister species as per the phylogram
. The results of Tajima’s D neutrality tests were negative for all the Salacia species population suggesting excess
of rare alleles within the population, which may suggest population expansion.
However, when the sample SF5 was removed and all the individual samples were
analyzed across species samples, there exist an equilibrium.

 

5 Conclusion

              Comparative
study of RAPD, ISSR and ITS for Salacia
species has given an insight into the efficiency of each technique in detecting
diversity within and among the population sampled in the western Ghats of
Karnataka.